Addgene
Part:BBa K1825004 - parts.igem.org
Detection of the CaMV-35S Promoter Sequence in Maize Pollen and Seed | Semantic Scholar
The Cauliflower Mosaic Virus 35S Promoter Extends into the Transcribed Region | Journal of Virology
Bidirectionalization of polar promoters in plants | Nature Biotechnology
Addgene: pMpGWB106
Plants | Free Full-Text | Evaluation of Plant-Derived Promoters for Constitutive and Tissue-Specific Gene Expression in Potato
Promoters
Strategies to mitigate transgene–promoter interactions - Gudynaite‐Savitch - 2009 - Plant Biotechnology Journal - Wiley Online Library
High-efficiency protein expression in plants from agroinfection-compatible Tobacco mosaic virusexpression vectors | BMC Biotechnology | Full Text
Domains of the CaMV 35S promoter (Benfey et al., 1990) and enhanced... | Download Scientific Diagram
Primary structure of the 35S-luciferase gene and primers used in RT-PCR... | Download Scientific Diagram
Addgene: pP35S (GB0030)
Solved Here the 203bp CaMV 35S promoter sequence that you | Chegg.com
CaMV35S promoter – A plant biology and biotechnology workhorse in the era of synthetic biology - ScienceDirect
Name of Primer Sequence (5' - 3') 35S promoter primer forward AGGAAACAGCTATGACCATG reverse GAACTTCCTTATATAGAGGAAGG actin primer
IJMS | Free Full-Text | A Novel Moderate Constitutive Promoter Derived from Poplar (Populus tomentosa Carrière)
The Use of 35S and Tnos Expression Elements in the Measurement of Genetically Engineered Plant Materials
Frontiers | Cauliflower mosaic virus (CaMV) Biology, Management, and Relevance to GM Plant Detection for Sustainable Organic Agriculture
11
Development of a general method for detection and quantification of the P35S promoter based on assessment of existing methods | Scientific Reports
Solved Here the 203bp CaMV 35 S promoter sequence that you | Chegg.com
Name of Primer Sequence (5' - 3') 35S promoter primer forward AGGAAACAGCTATGACCATG reverse GAACTTCCTTATATAGAGGAAGG actin primer
Plants | Free Full-Text | A Core35S Promoter of Cauliflower Mosaic Virus Drives More Efficient Replication of Turnip Crinkle Virus
Tuning the Transcriptional Activity of the CaMV 35S Promoter in Plants by Single-Nucleotide Changes in the TATA Box | ACS Synthetic Biology
Functional Characterization of a Strong Bi-directional Constitutive Plant Promoter Isolated from Cotton Leaf Curl Burewala Virus | PLOS ONE
